Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes

Denia Dwi Citra Resmi, Topik Hidayat, Siti Sriyati

Abstract


Indonesia has been estimated to contain 20,000 species of Magnoliophyta around the world. The current status of Indonesia's biodiversity shows that only 15.5% of the total flora in Indonesia has been identified. This is such a low percentage, requires researchers to obtain a rapid identification method, so that unidentified species can be grouped, at least at the level of the Magnoliopsida and Liliopsida classes. DNA barcoding is a technique that can be used to quickly identify species based on short sequences of specific regions in the genome. The purpose of this study was to analyze the relationship between Magnoliopsida and Liliopsida plants based on the mat-K marker and to obtain DNA barcodes for each of the Magnoliopsida and Liliopsida classes. This study used an in silico approach because the molecular data about these two selected classes with 101 species for samples are abundant in Genbank NCBI database. The primary design was carried out after analyzing the phylogenetic relationship between Magnoliopsida and Liliopsida. In silico analysis using BioEdit and PAUP to reconstructthe phylogenetic tree based on mat-K DNA showed results that were in line with previous studies. The phylogenetic tree using molecular data confirms that Magnoliopsida is the ancestor of Liliopsida. This study succeeded in obtaining two pairs of specific primers for Magnoliopsida and Liliopsida, which are cttcagtggtacggagtcaaat and gagccaaagttttagcacaagaa for Magnoliopsida, whereas cccatccatatggaaatcttggt and ttgaagccagaattgcttttcc for Liliopsida. These primers can later be used to distinguish the Magnoliopsida group from Liliopsida.


Keywords


DNA barcode, Liliopsida, Magnoliopsida, mat-K, Phylogenetics

Full Text:

PDF

References


Anonym. (2018). Indonesia, Negara Megabiodiversitas. Retrieved from https://indonesia.go.id/ragam/keanekaragaman-hayati/ekonomi/indonesia-negara-megabiodiversitas Barthet, M. M. & Hilu, K. W. (2007). Expression of matK: Functional and Evolutionary Implications. American Journal of Botany, 94(8), 1402–1412.

Campbell, N. A., Reece, J. B., Urry, L. A., Cain, M. L., Wasserman, S. A., Minorsky, P. V, & Jackson, R. (2008). Biology. San Francisco: Pearson, Benjamin Cummings.

Cristescu, M. E. (2014). From Barcoding Single Individuals to Metabarcoding Biological Communities: Towards an Integrative Approach to the Study of Global biodiversity. Trends in Ecology and Evolution, 29(10), 566–571.

Darajati, W., Pratiwi, S., Herwinda, E., Radiansyah, A. D., Nalang, V. S., Nooryanto, B. & Hakim, F. (2016). Indonesia Biodiversity Startegy and Action Plan (IBSAP), 2012-2020. Jakarta: BAPPENAS.

Datta, S. (2018). How Do I Edit Away These Strage Nucleotide Letters (N, K, Y, B, etc) from a Sanger Sequence DNA? Retrieved from https://www.researchgate.net/post/How_do_i_edit_away_these_strange_nucleotide_letters_N_K_Y_B_etc_from_a_Sanger_sequence_DNA_read/5af7213a35e538013a5ae352/citation/download

Hebert, P. D. N., Cywinska, A., Ball, S. L., DeWaard, J. R., Hebert, P. D. N. & Cywinska, A. (2003). Biological Identifications Through DNA Barcodes. Proceedings of the Royal Society B: Biological Sciences, 270(1512), 313–321.

Hidayat, T., Saputro, N. W., Khamid, M. B. R., Bayfurqon, F. M., Hidayat, T., & Saputro, N. W. (2021). First Phylogenetic Treatment of Apple Cucumber (Family cucurbitaceae) from Indonesia Utilizing DNA Variation of Internal Transcibed Spacer Region. HAYATI Journal of Biosciences, 28(1), 48–53.

Hussain, M. A., Verma, V. & Abdin, M. Z. (2008). Molecular Analysis of Dicot-Monocot Split and Relationship Among Major Angiosperm Groups. African Journal of Plant Science, 2, 1–4.

Kalendar, R., Lee, D., & Schulman, A. H. (2014). FastPC Software for PCR, in Silico PCR, and Oligonucleotide assembly and analysis. Methods in Molecular Biology (Clifton, N.J.), 1116, 271–302.

Kusmana, C. & Hikmat, A. (2015). The Biodiversity of Flora in Indonesia. Journal of Natural Resources and Environmental Management, 5(2), 187–198.

Retnaningati, D. (2018). Hubungan Filogenetik Intraspesies Cucumis Melo L. Berdasarkan DNA Barcode Gen matK. Journal of Biota, 2(2), 62–67.

Retnowati, A., Rugayah, Rahajoe, J. S., Arifiani, D., Retnowati, A. & Rugayah. (2019). Status Keanekaragaman Hayati Indonesia: Kekayaan Jenis Tumbuhan dan Jamur Indonesia. Jakarta: LIPI Press.

Samuel, R., Gutermann, W., Stuessy, T. F., Ruas, C. F., Lack, H. W., Tremetsberger, K. & Ehrendorfer, F. (2006). Molecular Phylogenetics Reveals Leontodon (Asteraceae, Lactuceae) to be Diphyletic. American Journal of Botany, 93(8), 1193–1205.

Simpson, M. G. (2006). Plant Systematics. London: Elsevier Academic Press.

Suparman. (2012). Markah molekuler dalam Identifikasi dan Analisis Kekerabatan Tumbuhan Serta Implikasinya Bagi Mata Kuliah Genetika. Jurnal Bioedukasi, 1(1), 59–68. Sutarno, & Setyawan, A. D. (2015). Biodiversitas Indonesia: Penurunan dan Upaya Pengelolaan untuk Menjamin Kemandirian Bangsa, 1, 1–13.

Witarto, A. B. & Sajidan. (2010). Bioinformatika: Trend dan Prospek dalam Pengembangan Keilmuan Biologi. Prosiding Seminar Biologi, 7(1), 15–16.

Zhang, D., & Jiang, B. (2020). Species identification in complex groups of medicinal plants based on DNA barcoding: a case study on Astragalus spp. (Fabaceae) from southwest China. Conservation Genetics Resources, 12(3), 469–478.




DOI: https://doi.org/10.15575/biodjati.v6i2.13991

Refbacks

  • There are currently no refbacks.


Copyright (c) 2021 Jurnal Biodjati



Indexing By :

      

      

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

 

View My Stats